wild type meg 01 cells Search Results


97
ATCC ago2 deletion wild type meg 01 cells
Fig. 1. Characterization of <t>Ago2-deleted</t> murine platelets. Whole citrated blood collection from Eif2c2fl/fl/Pf4- Cre (Ago2 KO) or Pf4-Cre mice was subject to complete blood count analysis using a HEMAVET analyzer. (A) Platelet counts. (B) Mean platelet volumes (MPV). (C) Platelet counts by sex, shown as box and whisker distribution plots with max/min. (A, C); no significant difference between groups. (D) MPV by sex. (E) Platelet counts following platelet depletion with anti-Gp1bα antibodies. (F) MPV of platelets from (E). (G) Platelet lifespan monitored by non-depleting X488-Gp1bβ antibodies (X488) as described in Methods. Lines in (A- D) indicate median values. Error bars indicate s.e.m. n.s., no significant difference; other data are n.s. unless indicated otherwise. (A-D), n = 25 each; (E-F), n = 3 each. *, p < 0.05; otherwise, no significant differences between groups.
Ago2 Deletion Wild Type Meg 01 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pm39875491-212-3-8?v=ATCC
Average 97 stars, based on 1 article reviews
ago2 deletion wild type meg 01 cells - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

hal 01  (DSMZ)
94
DSMZ hal 01
Mean IC 50 concentrations of HDM201 for the panel of B cell lines.
Hal 01, supplied by DSMZ, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pmc11763703-62-8-31?v=DSMZ
Average 94 stars, based on 1 article reviews
hal 01 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

97
ATCC type sars cov 2
Mean IC 50 concentrations of HDM201 for the panel of B cell lines.
Type Sars Cov 2, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pm34106944-77-2-15?v=ATCC
Average 97 stars, based on 1 article reviews
type sars cov 2 - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

95
ATCC c sakazakii atcc baa 894 wild type
Mean IC 50 concentrations of HDM201 for the panel of B cell lines.
C Sakazakii Atcc Baa 894 Wild Type, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pmc08619257-138-28-30?v=ATCC
Average 95 stars, based on 1 article reviews
c sakazakii atcc baa 894 wild type - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

94
Danaher Inc rpmi 1640
Mean IC 50 concentrations of HDM201 for the panel of B cell lines.
Rpmi 1640, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pmc06883975-49-9-11?v=Danaher+Inc
Average 94 stars, based on 1 article reviews
rpmi 1640 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
Alcami Inc baculoviruses encoding wild type rm131
Mean IC 50 concentrations of HDM201 for the panel of B cell lines.
Baculoviruses Encoding Wild Type Rm131, supplied by Alcami Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/10__1074_slash_jbc__m117__785121-95-9-23?v=Alcami+Inc
Average 90 stars, based on 1 article reviews
baculoviruses encoding wild type rm131 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

99
Dojindo Labs apoptosis cell counting kit 8 cck 8 assay
Mean IC 50 concentrations of HDM201 for the panel of B cell lines.
Apoptosis Cell Counting Kit 8 Cck 8 Assay, supplied by Dojindo Labs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/10__2147_slash_cmar__s177508-59-3-9?v=Dojindo+Labs
Average 99 stars, based on 1 article reviews
apoptosis cell counting kit 8 cck 8 assay - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
Vazyme Biotech Co tunel bright red apoptosis detection kit
H19 is required for gefitinib resistance of NSCLC cells. (A) The silencing efficacy of three siRNAs targeting H19 was evaluated, *P<0.05; **P<0.01; ***P<0.001 compared to si-NC. (B) The oligonucleotides labeled with GFP green fluorescence were transfected as described in Materials and methods (presented in an ×10 magnification). (C) A CCK-8 assay was performed to evaluate the effect of H19 silencing on cell viability, *P<0.05. (D) Flow cytometric assay for cell <t>apoptosis</t> displaying the effect of knockdown of H19, *P<0.05 compared to si-NC. (E) A <t>TUNEL</t> assay was used to determine the effect of H19 in gefitinib-induced nuclear apoptosis of HCC827R (presented in an ×10 magnification), *P<0.05 compared to si-NC. NSCLC, non-small cell lung cancer.
Tunel Bright Red Apoptosis Detection Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pmc06196604-79-13-21?v=Vazyme+Biotech+Co
Average 96 stars, based on 1 article reviews
tunel bright red apoptosis detection kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Vazyme Biotech Co tunel brightgreen apoptosis detection kit
a Relative expression of ROS-related genes in desat1 -silenced female mosquitoes fed with a sugar or blood meal (12 h PBM). b Hydrogen peroxide (H 2 O 2 ) content of desat1 -silenced female mosquitoes that were provided sugar only or a blood meal (12 h PBM) ( n = 20). c Schematic diagram of the inferred apoptotic pathway in An. stephensi (red text), with D. melanogaster as a reference (gene names in parentheses) . d Relative expression of <t>apoptosis-related</t> genes in desat1 -silenced female mosquitoes fed sugar only or a blood meal (12 h PBM). e <t>TUNEL</t> staining of fat bodies from desat1 -silenced females at 12 h PBM ( n = 15). The proportion of TUNEL-positive cells relative to DAPI-stained cells was quantified. The scale bar is 200 μm. The horizontal lines in the graph represent medians, with error bars indicating the SEM. Significance was determined using the Mann-Whitney test. CASPS7 ( f ) and CASPL2 ( g ) activity in fat bodies of ds desat1 - and ds GFP -injected females at 12 h PBM ( n = 30). h Post-blood-meal survival of desat1 -silenced females supplemented with palmitoleic acid (C16:1) or oleic acid (C18:1) ( n = 30). Statistics were performed using the Log-rank (Mantel-Cox) test. i H 2 O 2 content of desat1 -silenced females supplemented with 200 μM palmitoleic acid (C16:1) or oleic acid (C18:1), measured at 12 h PBM ( n = 20). An equivalent volume of ethanol as USFA stock solution was used as a control. j Proportion of TUNEL-positive cells at 12 h PBM in fat bodies of desat1 -silenced females supplemented with 200 μM palmitoleic acid (C16:1) or oleic acid (C18:1) ( n = 15). The horizontal lines represent medians, and error bars indicate SEM. Significance was determined using the Mann-Whitney test. Unless noted otherwise, female mosquitoes were injected with dsdesat1 or dsGFP (control) at 18 h PE and were analyzed after a 3-day recovery. Statistical significance was performed using Student’s t -test. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All experiments were repeated at least two times with similar results. Source data are provided as a Source Data file.
Tunel Brightgreen Apoptosis Detection Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pmc12647148-316-16-22?v=Vazyme+Biotech+Co
Average 96 stars, based on 1 article reviews
tunel brightgreen apoptosis detection kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

97
Vazyme Biotech Co wild type lin28b
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Wild Type Lin28b, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/pmc10613206-416-26-22?v=Vazyme+Biotech+Co
Average 97 stars, based on 1 article reviews
wild type lin28b - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

99
Thermo Fisher mutant giiβ dna clones
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Mutant Giiβ Dna Clones, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/10__1091_slash_mbc__e11___01___0019-206-3-26?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
mutant giiβ dna clones - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

95
ATCC type gm csf
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Type Gm Csf, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+meg+01+cells/us11208450-91-21-60?v=ATCC
Average 95 stars, based on 1 article reviews
type gm csf - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

Image Search Results


Fig. 1. Characterization of Ago2-deleted murine platelets. Whole citrated blood collection from Eif2c2fl/fl/Pf4- Cre (Ago2 KO) or Pf4-Cre mice was subject to complete blood count analysis using a HEMAVET analyzer. (A) Platelet counts. (B) Mean platelet volumes (MPV). (C) Platelet counts by sex, shown as box and whisker distribution plots with max/min. (A, C); no significant difference between groups. (D) MPV by sex. (E) Platelet counts following platelet depletion with anti-Gp1bα antibodies. (F) MPV of platelets from (E). (G) Platelet lifespan monitored by non-depleting X488-Gp1bβ antibodies (X488) as described in Methods. Lines in (A- D) indicate median values. Error bars indicate s.e.m. n.s., no significant difference; other data are n.s. unless indicated otherwise. (A-D), n = 25 each; (E-F), n = 3 each. *, p < 0.05; otherwise, no significant differences between groups.

Journal: Scientific reports

Article Title: Argonaute2 modulates megakaryocyte development and sex-specific control of platelet protein expression and reactivity.

doi: 10.1038/s41598-025-88106-0

Figure Lengend Snippet: Fig. 1. Characterization of Ago2-deleted murine platelets. Whole citrated blood collection from Eif2c2fl/fl/Pf4- Cre (Ago2 KO) or Pf4-Cre mice was subject to complete blood count analysis using a HEMAVET analyzer. (A) Platelet counts. (B) Mean platelet volumes (MPV). (C) Platelet counts by sex, shown as box and whisker distribution plots with max/min. (A, C); no significant difference between groups. (D) MPV by sex. (E) Platelet counts following platelet depletion with anti-Gp1bα antibodies. (F) MPV of platelets from (E). (G) Platelet lifespan monitored by non-depleting X488-Gp1bβ antibodies (X488) as described in Methods. Lines in (A- D) indicate median values. Error bars indicate s.e.m. n.s., no significant difference; other data are n.s. unless indicated otherwise. (A-D), n = 25 each; (E-F), n = 3 each. *, p < 0.05; otherwise, no significant differences between groups.

Article Snippet: MEG-01 cells and AGO2 deletion Wild-type MEG-01 cells (ATCC line CRL-2021) were cultured in RPMI medium (Gibco, Grand Island, NY, USA) with 10% FBS (Corning, Corning, NY, USA), 1% non-essential amino acids (Cytiva, Amersham, United Kingdom), and 1% penicillin/streptomycin (GE HealthCare Life Sciences, Chicago, IL, USA) in a humidified, 5% CO2 atmosphere at 37 C. Cells were cultured in EasYFlasks (Thermo Scientific, Waltham, ME, USA) and treated with 50 ng/mL of phorbol myristate acetate (PMA, Sigma-Aldrich, St. Louis, MO) to induce differentiation and platelet-like particle formation.

Techniques: Whisker Assay

Fig. 2. Altered megakaryocyte development in Ago2 KO mice. (A) Representative femurs and spleens obtained from Pf4-Cre or Ago2 KO mice, sectioned and stained with hematoxylin and eosin. Bars, 200 μm. (B) Quantification of megakaryocytes from images as in (A). (C) Mean forward scatter (FSC) of femur megakaryocytes identified with Cd42d fluorophore-conjugated antibodies by flow cytometry. (D) Ploidy as a function of FSC in megakaryocytes from (C), identified by propidium iodide staining. (E) Quantification of megakaryocyte area from femoral sections from (A), subject to immunohistochemical staining with Cd42d fluorophore-conjugated antibodies, shown + s.e.m. (F) Percentage of femur megakaryocytes per ploidy class from (D). n = 4; *, p < 0.05; **, p < 0.01; ***, p < 0.001. n.s., no significant differences.

Journal: Scientific reports

Article Title: Argonaute2 modulates megakaryocyte development and sex-specific control of platelet protein expression and reactivity.

doi: 10.1038/s41598-025-88106-0

Figure Lengend Snippet: Fig. 2. Altered megakaryocyte development in Ago2 KO mice. (A) Representative femurs and spleens obtained from Pf4-Cre or Ago2 KO mice, sectioned and stained with hematoxylin and eosin. Bars, 200 μm. (B) Quantification of megakaryocytes from images as in (A). (C) Mean forward scatter (FSC) of femur megakaryocytes identified with Cd42d fluorophore-conjugated antibodies by flow cytometry. (D) Ploidy as a function of FSC in megakaryocytes from (C), identified by propidium iodide staining. (E) Quantification of megakaryocyte area from femoral sections from (A), subject to immunohistochemical staining with Cd42d fluorophore-conjugated antibodies, shown + s.e.m. (F) Percentage of femur megakaryocytes per ploidy class from (D). n = 4; *, p < 0.05; **, p < 0.01; ***, p < 0.001. n.s., no significant differences.

Article Snippet: MEG-01 cells and AGO2 deletion Wild-type MEG-01 cells (ATCC line CRL-2021) were cultured in RPMI medium (Gibco, Grand Island, NY, USA) with 10% FBS (Corning, Corning, NY, USA), 1% non-essential amino acids (Cytiva, Amersham, United Kingdom), and 1% penicillin/streptomycin (GE HealthCare Life Sciences, Chicago, IL, USA) in a humidified, 5% CO2 atmosphere at 37 C. Cells were cultured in EasYFlasks (Thermo Scientific, Waltham, ME, USA) and treated with 50 ng/mL of phorbol myristate acetate (PMA, Sigma-Aldrich, St. Louis, MO) to induce differentiation and platelet-like particle formation.

Techniques: Staining, Flow Cytometry, Immunohistochemical staining

Fig. 3. Sex-selective increased thromboxane reactivity in Ago2-deleted platelets. Platelets from Pf4-Cre (black lines and circles) or Ago2 KO mice (red lines and circles) were subject to agonist stimulation as indicated in the presence of fluorophore-conjugated antibodies against activated αIIbβ3 integrin (Jon/A) and P-selectin (Cd62p), and measured by flow cytometry. (A) U46619. (B) Thrombin. (C) ADP. (D) Convulxin. (A-D) n = 10 each. (E) Data from (A) separated by sex as indicated. n = 5 each. *, p < 0.05; **, p < 0.01; unlabeled data points showed no significant differences between groups. MFI, mean fluorescence intensities, shown ± s.e.m.

Journal: Scientific reports

Article Title: Argonaute2 modulates megakaryocyte development and sex-specific control of platelet protein expression and reactivity.

doi: 10.1038/s41598-025-88106-0

Figure Lengend Snippet: Fig. 3. Sex-selective increased thromboxane reactivity in Ago2-deleted platelets. Platelets from Pf4-Cre (black lines and circles) or Ago2 KO mice (red lines and circles) were subject to agonist stimulation as indicated in the presence of fluorophore-conjugated antibodies against activated αIIbβ3 integrin (Jon/A) and P-selectin (Cd62p), and measured by flow cytometry. (A) U46619. (B) Thrombin. (C) ADP. (D) Convulxin. (A-D) n = 10 each. (E) Data from (A) separated by sex as indicated. n = 5 each. *, p < 0.05; **, p < 0.01; unlabeled data points showed no significant differences between groups. MFI, mean fluorescence intensities, shown ± s.e.m.

Article Snippet: MEG-01 cells and AGO2 deletion Wild-type MEG-01 cells (ATCC line CRL-2021) were cultured in RPMI medium (Gibco, Grand Island, NY, USA) with 10% FBS (Corning, Corning, NY, USA), 1% non-essential amino acids (Cytiva, Amersham, United Kingdom), and 1% penicillin/streptomycin (GE HealthCare Life Sciences, Chicago, IL, USA) in a humidified, 5% CO2 atmosphere at 37 C. Cells were cultured in EasYFlasks (Thermo Scientific, Waltham, ME, USA) and treated with 50 ng/mL of phorbol myristate acetate (PMA, Sigma-Aldrich, St. Louis, MO) to induce differentiation and platelet-like particle formation.

Techniques: Flow Cytometry, Fluorescence

Fig. 4. Normal hemostasis and clot dynamics following vascular injury in platelet-specific Ago2-deleted mice. (A) Time to initial stoppage of bleeding after 1-mm diameter tail tip amputation in Pf4-Cre (black lines and circles) or Ago2 KO mice (red lines and circles). (B) Rebleeds following primary hemostasis. The line and error bars indicate median and interquartile ranges. (C) Time to hemostasis after rebleeds. The experiment was stopped at 1200 s. No significant differences between groups were observed. n = 20. (D) Data (A-C) separated by sex as indicated, shown ± s.e.m. (E-I) Hemostatic clot dynamics in cremaster muscle arterioles after laser injury, monitored by confocal intravital fluorescence microscopy. 21 injuries in 3 Pf4-Cre male mice and 20 injuries in 3 Ago2 KO male mice. (A) Platelet accumulation (Cd41 area). (B) Cd62p exposure. (C) Fibrin deposition. (H) Area under curve (AUC) for (E). (I) Peak in curves from (E). The line and error bars indicate median and interquartile ranges.

Journal: Scientific reports

Article Title: Argonaute2 modulates megakaryocyte development and sex-specific control of platelet protein expression and reactivity.

doi: 10.1038/s41598-025-88106-0

Figure Lengend Snippet: Fig. 4. Normal hemostasis and clot dynamics following vascular injury in platelet-specific Ago2-deleted mice. (A) Time to initial stoppage of bleeding after 1-mm diameter tail tip amputation in Pf4-Cre (black lines and circles) or Ago2 KO mice (red lines and circles). (B) Rebleeds following primary hemostasis. The line and error bars indicate median and interquartile ranges. (C) Time to hemostasis after rebleeds. The experiment was stopped at 1200 s. No significant differences between groups were observed. n = 20. (D) Data (A-C) separated by sex as indicated, shown ± s.e.m. (E-I) Hemostatic clot dynamics in cremaster muscle arterioles after laser injury, monitored by confocal intravital fluorescence microscopy. 21 injuries in 3 Pf4-Cre male mice and 20 injuries in 3 Ago2 KO male mice. (A) Platelet accumulation (Cd41 area). (B) Cd62p exposure. (C) Fibrin deposition. (H) Area under curve (AUC) for (E). (I) Peak in curves from (E). The line and error bars indicate median and interquartile ranges.

Article Snippet: MEG-01 cells and AGO2 deletion Wild-type MEG-01 cells (ATCC line CRL-2021) were cultured in RPMI medium (Gibco, Grand Island, NY, USA) with 10% FBS (Corning, Corning, NY, USA), 1% non-essential amino acids (Cytiva, Amersham, United Kingdom), and 1% penicillin/streptomycin (GE HealthCare Life Sciences, Chicago, IL, USA) in a humidified, 5% CO2 atmosphere at 37 C. Cells were cultured in EasYFlasks (Thermo Scientific, Waltham, ME, USA) and treated with 50 ng/mL of phorbol myristate acetate (PMA, Sigma-Aldrich, St. Louis, MO) to induce differentiation and platelet-like particle formation.

Techniques: Fluorescence, Microscopy

Fig. 5. Induced Ago1 expression in Ago2-deleted platelets. (A) Segment from Supplemental Table 1, showing Argonaute peptides identified in Pf4-Cre (WT) and Ago2 KO (KO) platelets by LC/MS/MS. Red boxes indicate Ago2-specific peptides or Ago1-specific peptides as indicated. (B) Platelet lysates as indicated were separated by SDS-PAGE and subject to immunoblotting with the indicated antibodies. Original blots are presented in Supplemental Fig. 4. (C) Densitometric quantitation of immunoblot results from (B). n = 3 each.

Journal: Scientific reports

Article Title: Argonaute2 modulates megakaryocyte development and sex-specific control of platelet protein expression and reactivity.

doi: 10.1038/s41598-025-88106-0

Figure Lengend Snippet: Fig. 5. Induced Ago1 expression in Ago2-deleted platelets. (A) Segment from Supplemental Table 1, showing Argonaute peptides identified in Pf4-Cre (WT) and Ago2 KO (KO) platelets by LC/MS/MS. Red boxes indicate Ago2-specific peptides or Ago1-specific peptides as indicated. (B) Platelet lysates as indicated were separated by SDS-PAGE and subject to immunoblotting with the indicated antibodies. Original blots are presented in Supplemental Fig. 4. (C) Densitometric quantitation of immunoblot results from (B). n = 3 each.

Article Snippet: MEG-01 cells and AGO2 deletion Wild-type MEG-01 cells (ATCC line CRL-2021) were cultured in RPMI medium (Gibco, Grand Island, NY, USA) with 10% FBS (Corning, Corning, NY, USA), 1% non-essential amino acids (Cytiva, Amersham, United Kingdom), and 1% penicillin/streptomycin (GE HealthCare Life Sciences, Chicago, IL, USA) in a humidified, 5% CO2 atmosphere at 37 C. Cells were cultured in EasYFlasks (Thermo Scientific, Waltham, ME, USA) and treated with 50 ng/mL of phorbol myristate acetate (PMA, Sigma-Aldrich, St. Louis, MO) to induce differentiation and platelet-like particle formation.

Techniques: Expressing, Liquid Chromatography with Mass Spectroscopy, SDS Page, Western Blot, Quantitation Assay

Mean IC 50 concentrations of HDM201 for the panel of B cell lines.

Journal: Cancers

Article Title: Targeting the MDM2-p53 Interaction with Siremadlin: A Promising Therapeutic Strategy for Treating TP53 Wild-Type Chronic Lymphocytic Leukemia

doi: 10.3390/cancers17020274

Figure Lengend Snippet: Mean IC 50 concentrations of HDM201 for the panel of B cell lines.

Article Snippet: Human B cell lines, including Nalm-6, OCI-Ly3, and HAL-01 (wild-type TP53 ), as well as Ramos, Raji, and Pfeiffer ( TP53 mutant), were acquired from authenticated cell line repositories (ATCC or DSMZ).

Techniques: Mutagenesis

H19 is required for gefitinib resistance of NSCLC cells. (A) The silencing efficacy of three siRNAs targeting H19 was evaluated, *P<0.05; **P<0.01; ***P<0.001 compared to si-NC. (B) The oligonucleotides labeled with GFP green fluorescence were transfected as described in Materials and methods (presented in an ×10 magnification). (C) A CCK-8 assay was performed to evaluate the effect of H19 silencing on cell viability, *P<0.05. (D) Flow cytometric assay for cell apoptosis displaying the effect of knockdown of H19, *P<0.05 compared to si-NC. (E) A TUNEL assay was used to determine the effect of H19 in gefitinib-induced nuclear apoptosis of HCC827R (presented in an ×10 magnification), *P<0.05 compared to si-NC. NSCLC, non-small cell lung cancer.

Journal: Oncology Reports

Article Title: Tumor-released lncRNA H19 promotes gefitinib resistance via packaging into exosomes in non-small cell lung cancer

doi: 10.3892/or.2018.6762

Figure Lengend Snippet: H19 is required for gefitinib resistance of NSCLC cells. (A) The silencing efficacy of three siRNAs targeting H19 was evaluated, *P<0.05; **P<0.01; ***P<0.001 compared to si-NC. (B) The oligonucleotides labeled with GFP green fluorescence were transfected as described in Materials and methods (presented in an ×10 magnification). (C) A CCK-8 assay was performed to evaluate the effect of H19 silencing on cell viability, *P<0.05. (D) Flow cytometric assay for cell apoptosis displaying the effect of knockdown of H19, *P<0.05 compared to si-NC. (E) A TUNEL assay was used to determine the effect of H19 in gefitinib-induced nuclear apoptosis of HCC827R (presented in an ×10 magnification), *P<0.05 compared to si-NC. NSCLC, non-small cell lung cancer.

Article Snippet: Cells were fixed and stained with TUNEL kit according to the manufacturer's instructions (TUNEL Bright-Red Apoptosis Detection kit; cat. no. A113; Vazyme Biotech Co., Ltd., Nanjing, China).

Techniques: Labeling, Fluorescence, Transfection, CCK-8 Assay, Flow Cytometry, TUNEL Assay

a Relative expression of ROS-related genes in desat1 -silenced female mosquitoes fed with a sugar or blood meal (12 h PBM). b Hydrogen peroxide (H 2 O 2 ) content of desat1 -silenced female mosquitoes that were provided sugar only or a blood meal (12 h PBM) ( n = 20). c Schematic diagram of the inferred apoptotic pathway in An. stephensi (red text), with D. melanogaster as a reference (gene names in parentheses) . d Relative expression of apoptosis-related genes in desat1 -silenced female mosquitoes fed sugar only or a blood meal (12 h PBM). e TUNEL staining of fat bodies from desat1 -silenced females at 12 h PBM ( n = 15). The proportion of TUNEL-positive cells relative to DAPI-stained cells was quantified. The scale bar is 200 μm. The horizontal lines in the graph represent medians, with error bars indicating the SEM. Significance was determined using the Mann-Whitney test. CASPS7 ( f ) and CASPL2 ( g ) activity in fat bodies of ds desat1 - and ds GFP -injected females at 12 h PBM ( n = 30). h Post-blood-meal survival of desat1 -silenced females supplemented with palmitoleic acid (C16:1) or oleic acid (C18:1) ( n = 30). Statistics were performed using the Log-rank (Mantel-Cox) test. i H 2 O 2 content of desat1 -silenced females supplemented with 200 μM palmitoleic acid (C16:1) or oleic acid (C18:1), measured at 12 h PBM ( n = 20). An equivalent volume of ethanol as USFA stock solution was used as a control. j Proportion of TUNEL-positive cells at 12 h PBM in fat bodies of desat1 -silenced females supplemented with 200 μM palmitoleic acid (C16:1) or oleic acid (C18:1) ( n = 15). The horizontal lines represent medians, and error bars indicate SEM. Significance was determined using the Mann-Whitney test. Unless noted otherwise, female mosquitoes were injected with dsdesat1 or dsGFP (control) at 18 h PE and were analyzed after a 3-day recovery. Statistical significance was performed using Student’s t -test. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All experiments were repeated at least two times with similar results. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Desat1-mediated lipid homeostasis mitigates 20E-induced lipotoxicity in blood-fed mosquitoes

doi: 10.1038/s41467-025-65407-6

Figure Lengend Snippet: a Relative expression of ROS-related genes in desat1 -silenced female mosquitoes fed with a sugar or blood meal (12 h PBM). b Hydrogen peroxide (H 2 O 2 ) content of desat1 -silenced female mosquitoes that were provided sugar only or a blood meal (12 h PBM) ( n = 20). c Schematic diagram of the inferred apoptotic pathway in An. stephensi (red text), with D. melanogaster as a reference (gene names in parentheses) . d Relative expression of apoptosis-related genes in desat1 -silenced female mosquitoes fed sugar only or a blood meal (12 h PBM). e TUNEL staining of fat bodies from desat1 -silenced females at 12 h PBM ( n = 15). The proportion of TUNEL-positive cells relative to DAPI-stained cells was quantified. The scale bar is 200 μm. The horizontal lines in the graph represent medians, with error bars indicating the SEM. Significance was determined using the Mann-Whitney test. CASPS7 ( f ) and CASPL2 ( g ) activity in fat bodies of ds desat1 - and ds GFP -injected females at 12 h PBM ( n = 30). h Post-blood-meal survival of desat1 -silenced females supplemented with palmitoleic acid (C16:1) or oleic acid (C18:1) ( n = 30). Statistics were performed using the Log-rank (Mantel-Cox) test. i H 2 O 2 content of desat1 -silenced females supplemented with 200 μM palmitoleic acid (C16:1) or oleic acid (C18:1), measured at 12 h PBM ( n = 20). An equivalent volume of ethanol as USFA stock solution was used as a control. j Proportion of TUNEL-positive cells at 12 h PBM in fat bodies of desat1 -silenced females supplemented with 200 μM palmitoleic acid (C16:1) or oleic acid (C18:1) ( n = 15). The horizontal lines represent medians, and error bars indicate SEM. Significance was determined using the Mann-Whitney test. Unless noted otherwise, female mosquitoes were injected with dsdesat1 or dsGFP (control) at 18 h PE and were analyzed after a 3-day recovery. Statistical significance was performed using Student’s t -test. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All experiments were repeated at least two times with similar results. Source data are provided as a Source Data file.

Article Snippet: The fat bodies attached to the epidermis were stained for apoptosis and cell nuclei using the TUNEL BrightGreen Apoptosis Detection Kit (A112, Vazyme, Nanjing, China) and DAPI Nuclear Staining Dye (C1005, Beyotime Biotech, Shanghai, China), respectively, according to the manufacturer’s protocols.

Techniques: Expressing, TUNEL Assay, Staining, MANN-WHITNEY, Activity Assay, Injection, Control

a Survival of 18 h PE desat1 -silenced females after feeding on different blood components ( n = 20). FBS: fetal bovine serum; BSA: bovine serum albumin; FAC: ferric ammonium citrate. b Quantification of 20E in females at 12 h and 24 h after feeding on blood components, as determined by UHPLC-MS/MS ( n = 30). c qPCR analysis of 20E receptor gene EcR expression at 24 h after feeding on blood components. Mosquitoes fed with NaCl/NaHCO 3 solution served as controls for each time point. d Survival of 18 h PE desat1 -silenced females injected with a 20E solution. Mosquitoes injected with ethanol solution served as controls ( n = 40). e qPCR analysis of ROS-related gene expression and f apoptosis-related gene expression in early desat1 -silenced females injected with 1 mM 20E solution. Error bars represent SEM. In a and d , statistics were performed using the Log-rank (Mantel-Cox) test. In b and c , statistical analysis was performed with multiple t-test, with correction for multiple comparisons using the Holm-Šídák method. In the remaining panels, statistics were performed with Student’s t -test. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All experiments were repeated at least two times with similar results. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Desat1-mediated lipid homeostasis mitigates 20E-induced lipotoxicity in blood-fed mosquitoes

doi: 10.1038/s41467-025-65407-6

Figure Lengend Snippet: a Survival of 18 h PE desat1 -silenced females after feeding on different blood components ( n = 20). FBS: fetal bovine serum; BSA: bovine serum albumin; FAC: ferric ammonium citrate. b Quantification of 20E in females at 12 h and 24 h after feeding on blood components, as determined by UHPLC-MS/MS ( n = 30). c qPCR analysis of 20E receptor gene EcR expression at 24 h after feeding on blood components. Mosquitoes fed with NaCl/NaHCO 3 solution served as controls for each time point. d Survival of 18 h PE desat1 -silenced females injected with a 20E solution. Mosquitoes injected with ethanol solution served as controls ( n = 40). e qPCR analysis of ROS-related gene expression and f apoptosis-related gene expression in early desat1 -silenced females injected with 1 mM 20E solution. Error bars represent SEM. In a and d , statistics were performed using the Log-rank (Mantel-Cox) test. In b and c , statistical analysis was performed with multiple t-test, with correction for multiple comparisons using the Holm-Šídák method. In the remaining panels, statistics were performed with Student’s t -test. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All experiments were repeated at least two times with similar results. Source data are provided as a Source Data file.

Article Snippet: The fat bodies attached to the epidermis were stained for apoptosis and cell nuclei using the TUNEL BrightGreen Apoptosis Detection Kit (A112, Vazyme, Nanjing, China) and DAPI Nuclear Staining Dye (C1005, Beyotime Biotech, Shanghai, China), respectively, according to the manufacturer’s protocols.

Techniques: Tandem Mass Spectroscopy, Expressing, Injection, Gene Expression

a Total fatty acids, palmitoleic acid (C16:1), and oleic acid (C18:1) content in the fat body of adult female mosquitoes at 24 h post−20E injection. Fatty acid content was measured using UPLC-MS/MS (3 independent repeats per group). b Expression of five key genes involved in fatty acid oxidation ( CPT1 , CPT2 , ACD , ECH , and 3HCD ) in early desat1 -silenced mosquitoes at 24 h post-20E injection. c Post-blood-meal survival of 18 h PE desat1 -silenced females with EcR or USP knockdown ( n = 40). Statistics were performed using the Log-rank (Mantel-Cox) test. d Relative expression of key genes involved in fatty acid oxidation in desat1 - and EcR -silenced mosquitoes at 12 h PBM. Error bars represent SEM. In a , b and d , statistics were performed with Student’s t test. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All experiments were repeated at least two times with similar results. e A model illustrating how loss of desat1 function disrupts lipid metabolism and leads to lethality following a blood meal. Silencing desat1 in newly emerged female mosquitoes impairs the conversion of SFAs to USFAs, thereby reducing triglyceride synthesis. The resulting decrease in USFA/SFA ratio leads to the accumulation of SFAs, triggering oxidative stress and cell apoptosis. Mechanistically, following a blood meal, proteins in the ingested blood stimulate 20E synthesis and activate the 20E signaling pathway, further enhancing fatty acid β-oxidation, increasing ROS production, and inducing apoptosis in the desat1 -silenced early-emerged female mosquitoes, ultimately leading to mosquito death. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Desat1-mediated lipid homeostasis mitigates 20E-induced lipotoxicity in blood-fed mosquitoes

doi: 10.1038/s41467-025-65407-6

Figure Lengend Snippet: a Total fatty acids, palmitoleic acid (C16:1), and oleic acid (C18:1) content in the fat body of adult female mosquitoes at 24 h post−20E injection. Fatty acid content was measured using UPLC-MS/MS (3 independent repeats per group). b Expression of five key genes involved in fatty acid oxidation ( CPT1 , CPT2 , ACD , ECH , and 3HCD ) in early desat1 -silenced mosquitoes at 24 h post-20E injection. c Post-blood-meal survival of 18 h PE desat1 -silenced females with EcR or USP knockdown ( n = 40). Statistics were performed using the Log-rank (Mantel-Cox) test. d Relative expression of key genes involved in fatty acid oxidation in desat1 - and EcR -silenced mosquitoes at 12 h PBM. Error bars represent SEM. In a , b and d , statistics were performed with Student’s t test. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. All experiments were repeated at least two times with similar results. e A model illustrating how loss of desat1 function disrupts lipid metabolism and leads to lethality following a blood meal. Silencing desat1 in newly emerged female mosquitoes impairs the conversion of SFAs to USFAs, thereby reducing triglyceride synthesis. The resulting decrease in USFA/SFA ratio leads to the accumulation of SFAs, triggering oxidative stress and cell apoptosis. Mechanistically, following a blood meal, proteins in the ingested blood stimulate 20E synthesis and activate the 20E signaling pathway, further enhancing fatty acid β-oxidation, increasing ROS production, and inducing apoptosis in the desat1 -silenced early-emerged female mosquitoes, ultimately leading to mosquito death. Source data are provided as a Source Data file.

Article Snippet: The fat bodies attached to the epidermis were stained for apoptosis and cell nuclei using the TUNEL BrightGreen Apoptosis Detection Kit (A112, Vazyme, Nanjing, China) and DAPI Nuclear Staining Dye (C1005, Beyotime Biotech, Shanghai, China), respectively, according to the manufacturer’s protocols.

Techniques: Injection, Tandem Mass Spectroscopy, Expressing, Knockdown

a IHC was performed on a PDAC patient TMA with LIN28B antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a IHC was performed on a PDAC patient TMA with LIN28B antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Expressing, Immunofluorescence, Western Blot, Comparison, Generated, Staining

a , b Real-time qPCR analysis ( a ) and western blotting analysis ( b ) for Lin28b expression in mCAFs cultured alone or co-cultured with indicated tumor cells. Representative of n = 3 independent experiments ( b ). c , d 14837CAFs were direct co-cultured with 14837T or 15376T for six days and then sorted by flow cytometric cell sorting (FACS) ( c ). The levels of Lin28b were measured by real-time qPCR ( d ). e – j 14837CAFs ( e – g ) or 15376CAFs ( h – j ) were ‍cultured with 15376T-CM for up to 6 days. CM was derived from 15376T with low density (30–40%) or high density (80–90%). Cells were collected for real-‍time qPCR ( e , h ) and Western blotting ( f , g , i , j ) at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( f , g , i , j ). k , l 14837CAFs ( k ) or 15376CAFs ( l ) ‍were cultured with 15376T-CM or Lin28b-KO 15376T-‍CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. m , n The levels of LIN28B in human PDAC cell lines were measured by real-time qPCR ( m ) and western blotting ( n ). Representative of n = 3 independent experiments ( n ). o human CAFs (hCAFs) were cultured with CM from human PDAC cell lines for 6 days. Then, LIN28B levels were measured by western blotting. Representative of n = 3 independent experiments ( p – r ) hCAFs were cultured with PANC-1-CM ( p ), LIN28B-KO PANC-1-CM ( p ), PANC03.27-CM ( q ), LIN28B-KO PANC03.27-CM ( q ), hPDAC1 # -CM ( r ), and LIN28B-KO hPDAC1 # -CM ( r ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( p ), PANC03.27 ( q ), and hPDAC1 # ( r ) were included as a positive control. Representative of n = 3 independent experiments. s Orthotopic PDAC tumors generated with 15376T or Lin28b-KO 15376T were analyzed by Lin28b and α-SMA immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( a , d , e , h , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , e , h , m ) or two-tailed unpaired Student’s t-tests ( d ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a , b Real-time qPCR analysis ( a ) and western blotting analysis ( b ) for Lin28b expression in mCAFs cultured alone or co-cultured with indicated tumor cells. Representative of n = 3 independent experiments ( b ). c , d 14837CAFs were direct co-cultured with 14837T or 15376T for six days and then sorted by flow cytometric cell sorting (FACS) ( c ). The levels of Lin28b were measured by real-time qPCR ( d ). e – j 14837CAFs ( e – g ) or 15376CAFs ( h – j ) were ‍cultured with 15376T-CM for up to 6 days. CM was derived from 15376T with low density (30–40%) or high density (80–90%). Cells were collected for real-‍time qPCR ( e , h ) and Western blotting ( f , g , i , j ) at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( f , g , i , j ). k , l 14837CAFs ( k ) or 15376CAFs ( l ) ‍were cultured with 15376T-CM or Lin28b-KO 15376T-‍CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. m , n The levels of LIN28B in human PDAC cell lines were measured by real-time qPCR ( m ) and western blotting ( n ). Representative of n = 3 independent experiments ( n ). o human CAFs (hCAFs) were cultured with CM from human PDAC cell lines for 6 days. Then, LIN28B levels were measured by western blotting. Representative of n = 3 independent experiments ( p – r ) hCAFs were cultured with PANC-1-CM ( p ), LIN28B-KO PANC-1-CM ( p ), PANC03.27-CM ( q ), LIN28B-KO PANC03.27-CM ( q ), hPDAC1 # -CM ( r ), and LIN28B-KO hPDAC1 # -CM ( r ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( p ), PANC03.27 ( q ), and hPDAC1 # ( r ) were included as a positive control. Representative of n = 3 independent experiments. s Orthotopic PDAC tumors generated with 15376T or Lin28b-KO 15376T were analyzed by Lin28b and α-SMA immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( a , d , e , h , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , e , h , m ) or two-tailed unpaired Student’s t-tests ( d ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Western Blot, Expressing, Cell Culture, FACS, Derivative Assay, Positive Control, Generated, Immunofluorescence, Staining, Comparison, Two Tailed Test

a Venn diagram of genes upregulated in 15376T compared with Lin28b-KO 15376T and 14837T as determined by RNA-sequencing (RNA-seq). b , c The levels of Wnt5a in 15376T, Lin28b-KO 15376T, and 14837T were measured by real-‍time qPCR ( b ) and western blotting ( c ). Representative of n = 3 independent experiments ( c ). d , e The levels of WNT5A in PANC-1, LIN28B-KO PANC-1, and Mia Paca-2 were measured by real-‍time qPCR ( d ) and western blotting ( e ). Representative of n = 3 independent experiments ( e ). f Wnt5a levels in the supernatants of 15376T, Lin28b-KO 15376T, and 14837T were examined by ELISA. g WNT5A levels in the supernatants of PANC-1, LIN28B-KO PANC-1 and Mia Paca-2 were examined by ELISA. h , i 14837CAFs ( h ) or 15376CAFs ( i ) ‍were cultured with 15376T-CM or Wnt5a-KO 15376T-CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. j – l hCAFs were cultured with PANC-1-CM ( j ), WNT5A-KO PANC-1-CM ( j ), PANC03.27-CM ( k ), WNT5A-KO PANC03.27-CM ( k ), hPDAC1 # -CM ( l ), and WNT5A-KO hPDAC1 # -CM ( l ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( j ), PANC03.27 ( k ), and hPDAC1 # ( l ) were included as a positive control. Representative of n = 3 independent experiments. m Wnt5a levels in the supernatants of low (30–40%) and high (80–90%) density inoculated 15376T were examined by ELISA. n – q 14837CAFs ( n , o ) or 15376CAFs ( p , q ) were ‍treated with 100 ng/ml or 200 ng/ml recombinant-Wnt5a(r-mWnt5a) for 6 days. Cells were collected for Western blotting at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( n – q ). r , s 14837CAFs ( r ) or 15376CAFs ( s ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 1 μg/ml Wnt5a neutralizing antibody (anti-Wnt5a) for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( r , s ). t Orthotopic PDAC tumors generated with 15376T or Wnt5a-KO 15376T were analyzed by Wnt5a, Lin28b and α-SMA immunofluorescence staining (n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( b , d , f , g , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , g ) or two-tailed unpaired Student’s t-tests ( m ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a Venn diagram of genes upregulated in 15376T compared with Lin28b-KO 15376T and 14837T as determined by RNA-sequencing (RNA-seq). b , c The levels of Wnt5a in 15376T, Lin28b-KO 15376T, and 14837T were measured by real-‍time qPCR ( b ) and western blotting ( c ). Representative of n = 3 independent experiments ( c ). d , e The levels of WNT5A in PANC-1, LIN28B-KO PANC-1, and Mia Paca-2 were measured by real-‍time qPCR ( d ) and western blotting ( e ). Representative of n = 3 independent experiments ( e ). f Wnt5a levels in the supernatants of 15376T, Lin28b-KO 15376T, and 14837T were examined by ELISA. g WNT5A levels in the supernatants of PANC-1, LIN28B-KO PANC-1 and Mia Paca-2 were examined by ELISA. h , i 14837CAFs ( h ) or 15376CAFs ( i ) ‍were cultured with 15376T-CM or Wnt5a-KO 15376T-CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. j – l hCAFs were cultured with PANC-1-CM ( j ), WNT5A-KO PANC-1-CM ( j ), PANC03.27-CM ( k ), WNT5A-KO PANC03.27-CM ( k ), hPDAC1 # -CM ( l ), and WNT5A-KO hPDAC1 # -CM ( l ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( j ), PANC03.27 ( k ), and hPDAC1 # ( l ) were included as a positive control. Representative of n = 3 independent experiments. m Wnt5a levels in the supernatants of low (30–40%) and high (80–90%) density inoculated 15376T were examined by ELISA. n – q 14837CAFs ( n , o ) or 15376CAFs ( p , q ) were ‍treated with 100 ng/ml or 200 ng/ml recombinant-Wnt5a(r-mWnt5a) for 6 days. Cells were collected for Western blotting at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( n – q ). r , s 14837CAFs ( r ) or 15376CAFs ( s ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 1 μg/ml Wnt5a neutralizing antibody (anti-Wnt5a) for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( r , s ). t Orthotopic PDAC tumors generated with 15376T or Wnt5a-KO 15376T were analyzed by Wnt5a, Lin28b and α-SMA immunofluorescence staining (n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( b , d , f , g , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , g ) or two-tailed unpaired Student’s t-tests ( m ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: RNA Sequencing Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Culture, Positive Control, Recombinant, Generated, Immunofluorescence, Staining, Comparison, Two Tailed Test

a , b The mRNA levels of Lin28b, Wnt5a, and Fzd4 in indicated cells were measured by real-time qPCR. c , d 14837CAFs ( c ), Fzd4-KO 14837CAFs c , 15376CAFs and Fzd4-KO 15376CAFs ( d ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. e Fzd4-positive (Fzd4 + ) and Fzd4-negative (Fzd4 - ) CAFs from KPC mice were sorted by flow cytometry (FACS). Flow plots showing the gating strategy for sorting Fzd4 + and Fzd4 - CAFs from KPC tumors. f Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. g , h 14837CAFs, Fzd4-KO 14837CAFs ( g ), 15376CAFs, and Fzd4-KO 15376CAFs ( h ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting. Representative of n = 3 independent experiments. i Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting and quantification. Representative of n = 3 independent experiments. j A schematic illustration of the β-catenin binding sites in the Lin28b promoter. k , l 14837CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. ChIP experiments were performed using anti-β-catenin antibody. k, binding site 1; l, binding site 2. m The relative luciferase activity was analyzed after 14837CAFs were transfected with TCF/LEF reporter and pRL-TK vector and then cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 200 ng/ml r-mWnt5a for 3 days. n – r Western blotting was used to detect the knockdown efficiency of β-catenin in 14837CAFs ( n ) and 15376CAFs ( p ). Representative of n = 2 independent experiments. 14837CAFs and β-catenin-KD 14837CAFs ( o ), 15376CAFs and, and β-catenin-KD 15376CAFs ( q ) were cultured with 14837T-‍CM or 15376T-‍CM for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( o , q ). r , s Western blotting was used to detect the knockdown efficiency of β-catenin in hCAFs ( r ). Representative of n = 2 independent experiments. hCAFs and β-catenin-KD hCAFs were cultured with Mia Paca-2-‍CM or PANC-1-‍CM for 6 days. Then, cells were collected for Western blotting ( s ). Lin28b levels in PANC-1 were included as a positive control. Representative of n = 3 independent experiments ( s ). Three biologically independent experiments were performed ( a , b , i , k – m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , i , k – m ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a , b The mRNA levels of Lin28b, Wnt5a, and Fzd4 in indicated cells were measured by real-time qPCR. c , d 14837CAFs ( c ), Fzd4-KO 14837CAFs c , 15376CAFs and Fzd4-KO 15376CAFs ( d ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. e Fzd4-positive (Fzd4 + ) and Fzd4-negative (Fzd4 - ) CAFs from KPC mice were sorted by flow cytometry (FACS). Flow plots showing the gating strategy for sorting Fzd4 + and Fzd4 - CAFs from KPC tumors. f Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. g , h 14837CAFs, Fzd4-KO 14837CAFs ( g ), 15376CAFs, and Fzd4-KO 15376CAFs ( h ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting. Representative of n = 3 independent experiments. i Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting and quantification. Representative of n = 3 independent experiments. j A schematic illustration of the β-catenin binding sites in the Lin28b promoter. k , l 14837CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. ChIP experiments were performed using anti-β-catenin antibody. k, binding site 1; l, binding site 2. m The relative luciferase activity was analyzed after 14837CAFs were transfected with TCF/LEF reporter and pRL-TK vector and then cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 200 ng/ml r-mWnt5a for 3 days. n – r Western blotting was used to detect the knockdown efficiency of β-catenin in 14837CAFs ( n ) and 15376CAFs ( p ). Representative of n = 2 independent experiments. 14837CAFs and β-catenin-KD 14837CAFs ( o ), 15376CAFs and, and β-catenin-KD 15376CAFs ( q ) were cultured with 14837T-‍CM or 15376T-‍CM for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( o , q ). r , s Western blotting was used to detect the knockdown efficiency of β-catenin in hCAFs ( r ). Representative of n = 2 independent experiments. hCAFs and β-catenin-KD hCAFs were cultured with Mia Paca-2-‍CM or PANC-1-‍CM for 6 days. Then, cells were collected for Western blotting ( s ). Lin28b levels in PANC-1 were included as a positive control. Representative of n = 3 independent experiments ( s ). Three biologically independent experiments were performed ( a , b , i , k – m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , i , k – m ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Western Blot, Positive Control, Flow Cytometry, Binding Assay, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Comparison

Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( a , b , e – h , k – p ). a 15376T were co-cultured with or without 15376CAFs in transwell chambers and treated with complete media (25 mM glucose) or glucose-limited medium (2 mM glucose) for 2 days. The cells were counted to calculate the cell proliferation. b Tumors were co-cultured with 15376CAFs or Lin28b-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. c , d Lin28b-WT was stable expressed in 14837CAFs ( c ) and 15376CAFs ( d ). Tumors were co-cultured with 14837CAFs ( c ), Lin28b-WT-expressing 14837CAFs ( c ), 15376CAFs ( d ) or Lin28b-WT-expressing 15376CAFs ( d ) in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. e – g 15376T was orthotopically co-injected with 15376CAFs or Lin28b-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( e ) and analyzed by Ki-67 and CK19 IHC staining ( f ). Scale bar: 30 μM. The proportion of ki67-positive ( g ) cell was shown ( n = 10 views per group). Data are shown as mean ± s.d. h , i 14837T was orthotopically co-injected with or without 14837CAFs ( h ), Lin28b-WT-expressing 14837CAFs ( h ), 15376CAFs ( i ) or Lin28b-WT-expressing 15376CAFs ( i ) into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed. j Tumors were co-cultured with 15376CAFs or Fzd4-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. k Tumors were co-cultured with Fzd4 + CAFs or Fzd4 - CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. l – n 15376T was orthotopically co-injected with 15376CAFs or Fzd4-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( l ) and analyzed by Ki-67 and CK19 staining ( m ). Scale bar: 30 μM. The proportion of ki67-positive ( n ) cell was shown ( n = 10 views per group). o 15376T cells were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the tumors were analyzed by Lin28b and α-SMA immunofluorescence staining. Representative images are shown. Scale bar: 30 μM. p – r 15376T or Lin28b-KO 15376T were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the pancreas was weighed ( p ) and analyzed by Ki-67 and CK19 immunofluorescence staining ( q ). Scale bar: 30 μM. The proportion of ki67-positive ( r ) cell was shown ( n = 10 views per group). Four biologically independent experiments were performed ( a – d , j , k ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( a – d , h – k , p , r ) or two-tailed unpaired Student’s t-tests ( e , g , l , n ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( a , b , e – h , k – p ). a 15376T were co-cultured with or without 15376CAFs in transwell chambers and treated with complete media (25 mM glucose) or glucose-limited medium (2 mM glucose) for 2 days. The cells were counted to calculate the cell proliferation. b Tumors were co-cultured with 15376CAFs or Lin28b-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. c , d Lin28b-WT was stable expressed in 14837CAFs ( c ) and 15376CAFs ( d ). Tumors were co-cultured with 14837CAFs ( c ), Lin28b-WT-expressing 14837CAFs ( c ), 15376CAFs ( d ) or Lin28b-WT-expressing 15376CAFs ( d ) in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. e – g 15376T was orthotopically co-injected with 15376CAFs or Lin28b-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( e ) and analyzed by Ki-67 and CK19 IHC staining ( f ). Scale bar: 30 μM. The proportion of ki67-positive ( g ) cell was shown ( n = 10 views per group). Data are shown as mean ± s.d. h , i 14837T was orthotopically co-injected with or without 14837CAFs ( h ), Lin28b-WT-expressing 14837CAFs ( h ), 15376CAFs ( i ) or Lin28b-WT-expressing 15376CAFs ( i ) into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed. j Tumors were co-cultured with 15376CAFs or Fzd4-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. k Tumors were co-cultured with Fzd4 + CAFs or Fzd4 - CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. l – n 15376T was orthotopically co-injected with 15376CAFs or Fzd4-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( l ) and analyzed by Ki-67 and CK19 staining ( m ). Scale bar: 30 μM. The proportion of ki67-positive ( n ) cell was shown ( n = 10 views per group). o 15376T cells were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the tumors were analyzed by Lin28b and α-SMA immunofluorescence staining. Representative images are shown. Scale bar: 30 μM. p – r 15376T or Lin28b-KO 15376T were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the pancreas was weighed ( p ) and analyzed by Ki-67 and CK19 immunofluorescence staining ( q ). Scale bar: 30 μM. The proportion of ki67-positive ( r ) cell was shown ( n = 10 views per group). Four biologically independent experiments were performed ( a – d , j , k ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( a – d , h – k , p , r ) or two-tailed unpaired Student’s t-tests ( e , g , l , n ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Expressing, Injection, Immunohistochemistry, Staining, Immunofluorescence, Comparison, Two Tailed Test

Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily. a The ability of CAFs-CM to increase PDAC proliferation was abolished after boiling at 100 °C for 15 min as well as after three consecutive freeze (−80 °C, 10 min)-thaw (60 °C, 10 min) cycles. b The factor secreted by CAFs that increases PDAC proliferation was retained in the >3-kDa fraction of CAFs-CM. c CAFs were cultured with 15376T-‍CM for 6 days and then they were cultured with FBS-free 15376T-CM for 24 h. Then, CM from 15376CAFs or Lin28b-KO 15376CAFs were harvested for quantitative secretomics analysis. A heat map shows cytokines which are downregulated in Lin28b-KO 15376CAFs-CM. d , e CRISPR/Cas9-resistent flag-Lin28b-WT(r) and flag-Lin28b-MU(r) were overexpressed in Lin28b-KO CAFs. Western blotting was then performed to determine Lin28b protein levels ( d ). let-‍7 (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i, mir-98) levels were measured by real-time qPCR ( e ). Representative of n = 3 independent experiments ( d ). f – j The levels of Clu ( f ), Cxcl5 ( g ), FN ( h ), PGRN ( i ), and Pcsk9 ( j ) in the supernatants of indicated cells were examined by ELISA. k 15376T were ‍treated with 100 ng/ml recombinant PGRN (r-mPGRN) or 100 ng/ml recombinant Pcsk9 (r-‍mPcsk9) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. l 15376T were co-cultured with 15376CAFs in transwell chambers, and treated with or without 1 μg/ml neutralizing antibody (anti-Pcsk9 or anti-PGRN) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. m , n Western blotting was used to detect the knocking-out efficiency of Pcsk9 in 15376CAFs ( m ). Representative of n = 2 independent experiments. 15376T were co-cultured with 15376CAFs or Pcsk9-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation ( n ). o – s 15376T was orthotopically co-injected with 15376CAFs or Pcsk9-KO 15376CAFs into C57BL/6 J mice and the tumors were harvested after 1 week ( n = 6 mice). IHC was performed with Pcsk9 and α-SMA antibodies ( o ) and Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group) ( p ). The pancreas was weighed ( q ) and analyzed by Ki-67 and CK19 IHC staining ( r ). The proportion of ki67-positive ( s ) cell was shown ( n = 10 views per group). Scale bar: 30 μM. ( t ) 15376T were orthotopically injected into C57BL/6 J mice. About 200 μg anti-Pcsk9 monoclonal antibodies (alirocumab) were intraperitoneally injected on days 3, 5, 8, and 11. After 2 weeks, the pancreas was weighed ( n = 6 mice). Three biologically independent experiments were performed ( e , f – j , t ). Four biologically independent experiments were performed ( a , b , k , l ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , e – l , n ) or two-tailed unpaired Student’s t-tests ( p , q , s , t ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily. a The ability of CAFs-CM to increase PDAC proliferation was abolished after boiling at 100 °C for 15 min as well as after three consecutive freeze (−80 °C, 10 min)-thaw (60 °C, 10 min) cycles. b The factor secreted by CAFs that increases PDAC proliferation was retained in the >3-kDa fraction of CAFs-CM. c CAFs were cultured with 15376T-‍CM for 6 days and then they were cultured with FBS-free 15376T-CM for 24 h. Then, CM from 15376CAFs or Lin28b-KO 15376CAFs were harvested for quantitative secretomics analysis. A heat map shows cytokines which are downregulated in Lin28b-KO 15376CAFs-CM. d , e CRISPR/Cas9-resistent flag-Lin28b-WT(r) and flag-Lin28b-MU(r) were overexpressed in Lin28b-KO CAFs. Western blotting was then performed to determine Lin28b protein levels ( d ). let-‍7 (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i, mir-98) levels were measured by real-time qPCR ( e ). Representative of n = 3 independent experiments ( d ). f – j The levels of Clu ( f ), Cxcl5 ( g ), FN ( h ), PGRN ( i ), and Pcsk9 ( j ) in the supernatants of indicated cells were examined by ELISA. k 15376T were ‍treated with 100 ng/ml recombinant PGRN (r-mPGRN) or 100 ng/ml recombinant Pcsk9 (r-‍mPcsk9) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. l 15376T were co-cultured with 15376CAFs in transwell chambers, and treated with or without 1 μg/ml neutralizing antibody (anti-Pcsk9 or anti-PGRN) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. m , n Western blotting was used to detect the knocking-out efficiency of Pcsk9 in 15376CAFs ( m ). Representative of n = 2 independent experiments. 15376T were co-cultured with 15376CAFs or Pcsk9-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation ( n ). o – s 15376T was orthotopically co-injected with 15376CAFs or Pcsk9-KO 15376CAFs into C57BL/6 J mice and the tumors were harvested after 1 week ( n = 6 mice). IHC was performed with Pcsk9 and α-SMA antibodies ( o ) and Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group) ( p ). The pancreas was weighed ( q ) and analyzed by Ki-67 and CK19 IHC staining ( r ). The proportion of ki67-positive ( s ) cell was shown ( n = 10 views per group). Scale bar: 30 μM. ( t ) 15376T were orthotopically injected into C57BL/6 J mice. About 200 μg anti-Pcsk9 monoclonal antibodies (alirocumab) were intraperitoneally injected on days 3, 5, 8, and 11. After 2 weeks, the pancreas was weighed ( n = 6 mice). Three biologically independent experiments were performed ( e , f – j , t ). Four biologically independent experiments were performed ( a , b , k , l ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , e – l , n ) or two-tailed unpaired Student’s t-tests ( p , q , s , t ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Expressing, CRISPR, Western Blot, Enzyme-linked Immunosorbent Assay, Recombinant, Injection, Immunohistochemistry, Comparison, Two Tailed Test

Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( d – j , m – p ). a – d 14837CAFs ( a , b ), Lin28b-WT-expressing 14837CAFs ( a , b ), 15376CAFs ( c , d ), and Lin28b-WT-expressing 15376CAFs ( c , d ) were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Lin28b and Pcsk9 were measured by western blotting ( a , c ). The levels of Pcsk9 in the supernatants were examined by ELISA ( b , d ). Representative of n = 3 independent experiments ( a , c ). e , f 15376CAFs and Fzd4-KO 15376CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( e ). The levels of Pcsk9 in the supernatants were examined by ELISA ( f ). Representative of n = 3 independent experiments ( e ). g , h Fzd4 + CAFs and Fzd4 - CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). the levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( g ). The levels of Pcsk9 in the supernatants were examined by ELISA ( h ). Representative of n = 3 independent experiments ( g ). i The levels of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by western blotting. Representative of n = 3 independent experiments. j 15376CAFs were transfected with let-7a agomir or let-7 sponge vector. The protein levels of Lin28b and Pcsk9 were measured by western blotting. Representative of n = 3 independent experiments. k , l Sequence alignment of the putative let-7a binding sites, and sketch of the construction of wild-type or mutant Pcsk9 3’UTR ( k ). The relative luciferase activity was analyzed after the pmir-‍GLO-Pcsk9 3’UTR (wild-type or mutant) vectors were co-transfected into 293T cells with let-‍7a agomir or agomir nc ( l ). P -value by one-way ANOVA with Tukey’s multiple comparison test. m , n The mRNA expression level ( m ) and mRNA stability ( n ) of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by real-time qPCR. o , p 15376CAFs ( o ), Lin28b-KO 15376CAFs ( o ), flag-Lin28b-WT(r)-expressing 15376CAFs ( p ), and flag-Lin28b-MU(r)-expressing 15376CAFs ( p ) were collected and polysomes were fractionated on sucrose density gradients. Amount of Pcsk9 mRNA in various polysome fractions was analyzed by RT-PCR and normalized to 5S rRNA level. q , r 15376T cells were orthotopically injected into WT and FSP-Cre;Lin28b fl/fl mice. After 2 weeks, the tumors were analyzed by Pcsk9 and α-SMA IHC staining. Representative images are shown. Scale bar: 30 μM ( q ). Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group). Data are shown as mean±s.d. r Three biologically independent experiments were performed ( b , d , f , h , l – p ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , h , l – p ) or two-tailed unpaired Student’s t-tests ( r ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( d – j , m – p ). a – d 14837CAFs ( a , b ), Lin28b-WT-expressing 14837CAFs ( a , b ), 15376CAFs ( c , d ), and Lin28b-WT-expressing 15376CAFs ( c , d ) were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Lin28b and Pcsk9 were measured by western blotting ( a , c ). The levels of Pcsk9 in the supernatants were examined by ELISA ( b , d ). Representative of n = 3 independent experiments ( a , c ). e , f 15376CAFs and Fzd4-KO 15376CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( e ). The levels of Pcsk9 in the supernatants were examined by ELISA ( f ). Representative of n = 3 independent experiments ( e ). g , h Fzd4 + CAFs and Fzd4 - CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). the levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( g ). The levels of Pcsk9 in the supernatants were examined by ELISA ( h ). Representative of n = 3 independent experiments ( g ). i The levels of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by western blotting. Representative of n = 3 independent experiments. j 15376CAFs were transfected with let-7a agomir or let-7 sponge vector. The protein levels of Lin28b and Pcsk9 were measured by western blotting. Representative of n = 3 independent experiments. k , l Sequence alignment of the putative let-7a binding sites, and sketch of the construction of wild-type or mutant Pcsk9 3’UTR ( k ). The relative luciferase activity was analyzed after the pmir-‍GLO-Pcsk9 3’UTR (wild-type or mutant) vectors were co-transfected into 293T cells with let-‍7a agomir or agomir nc ( l ). P -value by one-way ANOVA with Tukey’s multiple comparison test. m , n The mRNA expression level ( m ) and mRNA stability ( n ) of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by real-time qPCR. o , p 15376CAFs ( o ), Lin28b-KO 15376CAFs ( o ), flag-Lin28b-WT(r)-expressing 15376CAFs ( p ), and flag-Lin28b-MU(r)-expressing 15376CAFs ( p ) were collected and polysomes were fractionated on sucrose density gradients. Amount of Pcsk9 mRNA in various polysome fractions was analyzed by RT-PCR and normalized to 5S rRNA level. q , r 15376T cells were orthotopically injected into WT and FSP-Cre;Lin28b fl/fl mice. After 2 weeks, the tumors were analyzed by Pcsk9 and α-SMA IHC staining. Representative images are shown. Scale bar: 30 μM ( q ). Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group). Data are shown as mean±s.d. r Three biologically independent experiments were performed ( b , d , f , h , l – p ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , h , l – p ) or two-tailed unpaired Student’s t-tests ( r ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Transfection, Plasmid Preparation, Sequencing, Binding Assay, Mutagenesis, Luciferase, Activity Assay, Comparison, Reverse Transcription Polymerase Chain Reaction, Injection, Immunohistochemistry, Two Tailed Test

Model of positive feedback loop between Wnt5a and Lin28b in PDAC. Tumor-‍secreted Wnt5a activates Wnt–β-catenin signaling pathway, inducing Lin28b expression in CAFs. Up-regulation of Lin28b in CAFs increases PDAC survival though promoting pcsk9 secretion.

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Model of positive feedback loop between Wnt5a and Lin28b in PDAC. Tumor-‍secreted Wnt5a activates Wnt–β-catenin signaling pathway, inducing Lin28b expression in CAFs. Up-regulation of Lin28b in CAFs increases PDAC survival though promoting pcsk9 secretion.

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Expressing